View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_low_32 (Length: 250)
Name: NF11527_low_32
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 15207913 - 15208153
Alignment:
| Q |
1 |
ctctcttcctcatgaaggtagtttgtcctcatattccgtttatgtattccttgttactttggcgatgtgggccttttctcatgggtgattggttgaaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15207913 |
ctctcttcctcatgaaggtagtttgtcctcatattccgtttatgtattccttgttactttggcgatgtgggccttttctcatgggtgattggttgaaatg |
15208012 |
T |
|
| Q |
101 |
ggcattggtcagtgtaatccaatttggaattgggaaacgcttttacgttgcagctggcagggctcttagaaatggttcaacaaacatggatgtcctaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15208013 |
ggcattggtcagtgtaatccaatttggaattgggaaacgcttttacgttgcagctggcagggctcttagaaatggttcaacaaacatggatgtcctaatt |
15208112 |
T |
|
| Q |
201 |
gctgtgggaactaccgcttcttacgtttactctgtctgtgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15208113 |
gctgtgggaactaccgcttcttacgtttactctgtctgtgc |
15208153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 3 - 243
Target Start/End: Original strand, 38745443 - 38745683
Alignment:
| Q |
3 |
ctcttcctcatgaaggtagtttgtcctcatattccgtttatgtattccttgttactttggcgatgtgggccttttctcatgggtgattggttgaaatggg |
102 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||| || || || || || || ||||||||| ||||||||||||| ||||||| |||||||||||| |||| |
|
|
| T |
38745443 |
ctcttcttcatgggggtaatttgtcctcatatcccattcatatactcgttattactttggagatgtgggcctttcctcatggatgattggttgaagtggg |
38745542 |
T |
|
| Q |
103 |
cattggtcagtgtaatccaatttggaattgggaaacgcttttacgttgcagctggcagggctcttagaaatggttcaacaaacatggatgtcctaattgc |
202 |
Q |
| |
|
||||||| ||||| || |||||||| ||||| || ||||||||| | |||||| ||| ||||| ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
38745543 |
cattggtgagtgtcattcaatttgggattggaaagcgcttttacatagcagctttcagagctctcagaaacggttcaacaaacatggatgtccttgttgc |
38745642 |
T |
|
| Q |
203 |
tgtgggaactaccgcttcttacgtttactctgtctgtgctc |
243 |
Q |
| |
|
| |||||||||| ||||| || ||||| ||||| ||||||| |
|
|
| T |
38745643 |
tttgggaactacagcttcatatgtttattctgtttgtgctc |
38745683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University