View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_low_36 (Length: 245)
Name: NF11527_low_36
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 51 - 229
Target Start/End: Original strand, 29336253 - 29336433
Alignment:
| Q |
51 |
taaatgtgttacttatagacaatgggacagagcacgtaattctattgcctataaatgaggcctacaaagattgcctct--gactgtcgttatttggctaa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29336253 |
taaatgtgttacttatagacaatgggacagagcacgtaattctattgcctataaatgaggcctacaaagattgcctctctgactgtcgttatttggctaa |
29336352 |
T |
|
| Q |
149 |
actcgcaggttatgtgtatggtttgtgactgttgttatgtgtacatggcacccccatattttgccatgttccccatgtttc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29336353 |
actcgcaggttatgtgtatggtttgtgactgttgttatgtgtacatggcacccccatattttgccatgttccccatgtttc |
29336433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 29336181 - 29336225
Alignment:
| Q |
9 |
aagcagagagacaaatgtaaaatgcgagtgaaactgataatttaa |
53 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29336181 |
aagcagaaagacaaatgtaaaatgcgagtgaaactgataatttaa |
29336225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University