View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_low_40 (Length: 228)
Name: NF11527_low_40
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 29242374 - 29242570
Alignment:
| Q |
18 |
tatttttcatttgtggcttcatataattcatggtaaaagaacttctccnnnnnnnncaatttggactattgtgtttgtcacacactttctttcatctcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29242374 |
tatttttcatttgtggcttcatataattcatggtaaaagaacttctccttttttttcaatttggactattgtgtttgtcacacactttctttcatctcat |
29242473 |
T |
|
| Q |
118 |
tagtgcctcacatgaggggaccaatgttaaaattaggttacannnnnnncatttctttcccctatgctatacattagattcagaatgtgtgtctctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29242474 |
tagtgcctcacatgaggggaccaatgttaaaattaggttacatttttttcatttctttcccctatgctatacattagattcagaatgtgtgtctctg |
29242570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University