View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_low_41 (Length: 226)
Name: NF11527_low_41
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 34234237 - 34234445
Alignment:
| Q |
18 |
aagatctatgtaccatttctctcaattcaatcaatttctctaccgtttccccccaaatttgagttacaattcannnnnnnn-------aacaatttaggg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34234237 |
aagatctatgtaccatttctctcaattcaatcaatttctctaccgtttccccccaaatttgtgttacaattcatttttatttttttttaacaatttaggg |
34234336 |
T |
 |
| Q |
111 |
tttcaagtaattttactcaaaattcaaattatgtttctatgtttgcacctctttaatcgc-nnnnnnngaacaattgttgtattg-ttttttggtaatct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
34234337 |
tttcaagtaattttactcaaaattcaaattatgtttctatgtttgcacctctttaatcgcttttttttgaacaattgttgtattgtttttttggtaatct |
34234436 |
T |
 |
| Q |
209 |
ctgcttctc |
217 |
Q |
| |
|
|| |||||| |
|
|
| T |
34234437 |
ctacttctc |
34234445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University