View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_low_46 (Length: 207)
Name: NF11527_low_46
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 50126860 - 50127034
Alignment:
| Q |
19 |
tccttttatagtgcagggatttaattgtctcagaaatggtagaccagatcaagattatctcaaatatagatggaaaccttttgcctgtgatcttccaagg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50126860 |
tccttttatagtgcagggatttaattgtctcagaaatgggagaccagatcaagattatctcaaatatagatggaaaccttttgcctgtgatcttccaagg |
50126959 |
T |
|
| Q |
119 |
taattatatatttatttagacaaaaaacttgttataacctaaacttttaatatattgtccttgttgttttcttct |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
50126960 |
taattatatatttatttagacaaaaaacttgttataacctagacttttaatatactgtcctagttgttttcttct |
50127034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University