View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11529_high_14 (Length: 262)
Name: NF11529_high_14
Description: NF11529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11529_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 51 - 156
Target Start/End: Original strand, 11819058 - 11819167
Alignment:
| Q |
51 |
ttcacacaaaaatagcttgcaaataaaatggcacacatccaaacccagtgttgtattttcatctttgaataattga----atctatctatctagttcatt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11819058 |
ttcacacaaaaatagcttgcaaataaaatggcacacatccaaacccagtattgtatttccatctttgaataattgaatatatctatctatctagttcatt |
11819157 |
T |
|
| Q |
147 |
tgcttattat |
156 |
Q |
| |
|
|||||||||| |
|
|
| T |
11819158 |
tgcttattat |
11819167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 6 - 135
Target Start/End: Original strand, 11805064 - 11805193
Alignment:
| Q |
6 |
agtttcatattatagtaccactcattcaatctccacacaaaaatgttcacacaaaaatagcttgcaaataaaatggcacacatccaaacccagtgttgta |
105 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||| || ||| ||||||||||||||| || ||||||||||||||||||||||| | || || |
|
|
| T |
11805064 |
agtttcatattataataccactcattcaatctccacataaaattgatcaaacaaaaatagcttgccaacaaaatggcacacatccaaacccaatattcta |
11805163 |
T |
|
| Q |
106 |
ttttcatctttgaataattgaatctatcta |
135 |
Q |
| |
|
||| |||||||||||||||| || |||||| |
|
|
| T |
11805164 |
tttccatctttgaataattggatatatcta |
11805193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 255
Target Start/End: Original strand, 11819219 - 11819297
Alignment:
| Q |
177 |
gttgcatttatctccccctagatgttgtgtcagagttggtgaggatgggatggttcaacattgattagcattgcctttg |
255 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11819219 |
gttgcatttatcttcccctagattttgtgtcagagttggtgaggatgggatggttcaacattgattagcattgcctttg |
11819297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 157 - 242
Target Start/End: Original strand, 11805250 - 11805335
Alignment:
| Q |
157 |
tatatctagttcatttgcttgttgcatttatctccccctagatgttgtgtcagagttggtgaggatgggatggttcaacattgatt |
242 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11805250 |
tatatctagttcatttgcgagttgcatttatctccccctagatcttgtgtcagagttggtgaggatgggatggttcaccattgatt |
11805335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 11820474 - 11820595
Alignment:
| Q |
1 |
ttcttagtttcatattatagt-accactcattcaatctccacacaaaaatgttcacacaaaaatagcttgcaaataaaatggcacacatccaaacccagt |
99 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||||||| || ||||||||||||||||| || |||||||||||||||| |||||| |
|
|
| T |
11820474 |
ttcttagtttcaaattatagttaccactcattcaacctccacacaaaaatattaacacaaaaatagcttgccaacaaaatggcacacatccgaacccaaa |
11820573 |
T |
|
| Q |
100 |
gttgtattttcatctttgaata |
121 |
Q |
| |
|
|||||| | |||||||||||| |
|
|
| T |
11820574 |
attgtatatccatctttgaata |
11820595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University