View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11529_high_15 (Length: 248)
Name: NF11529_high_15
Description: NF11529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11529_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 50462817 - 50463038
Alignment:
| Q |
15 |
gagatgtatttagttcatttatatcgttttagtgttgaatttagaaccattttaaataaatagtcaatttatttttaaattcttcggtcacttagatatc |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50462817 |
gagatgtatttaattcatttatatcgttttagtgttgaatttagaaccattttaaataaatagt--------ttttaaattcttcggtcacttagatatc |
50462908 |
T |
|
| Q |
115 |
tttgttattattttctccctaaacatgattaaagtaaactaaaactcatcttgttaagttatgattcaagttgtcctgcatcataacttaattaacaaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50462909 |
tttgttattattttctccctaaacatgattaaagtagactaaaactcatcttgttaagttatgattcaagttgtcctgcatcataacttaattaacaaca |
50463008 |
T |
|
| Q |
215 |
aaccacaaaagaacatcactataacttaat |
244 |
Q |
| |
|
|||||||||| || |||||||||||||||| |
|
|
| T |
50463009 |
aaccacaaaacaaaatcactataacttaat |
50463038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University