View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11529_high_3 (Length: 570)
Name: NF11529_high_3
Description: NF11529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11529_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 433; Significance: 0; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 433; E-Value: 0
Query Start/End: Original strand, 112 - 559
Target Start/End: Complemental strand, 32596916 - 32596468
Alignment:
| Q |
112 |
tcttgcagacatcatgggttacttcaatttcgatgccgagttcaaattgttacgctttcaataattcaagtcgaattgttgatttcgtatccttcatttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596916 |
tcttgcagacatcatgggttacttcaatttcgatgccgagttcaaattgttacgctttcaataattcaagtcgaattgttgatttcgtatccttcatttc |
32596817 |
T |
|
| Q |
212 |
cacatgcttcaagttttcaacttttattaggcattgcattttaacgttactaattgcaaatgggtcattattggattctaattttagtatattatggatg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596816 |
cacatgcttcaagttttcaacttttattaggcattgcattttaacgttactaattgcaaatgggtcattattggattctaattttagtatattatggatg |
32596717 |
T |
|
| Q |
312 |
tttttt-aatggtaactagtagtgttgttaaacgacgctcgaaatttgatcaaattgctattgctccgtggtacattatttagtacaaatattgtgaaat |
410 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596716 |
tttttttaatggtaactagtagtgttgttaaacgaagcgcgaaatttgatcaaattgctattgctccgtggtacattatttagtacaaatattgtgaaat |
32596617 |
T |
|
| Q |
411 |
catgactatattggcgctatagcactgttgcatagcagaaacaaattaccattttccgcgatttgcaattggcaacactggtaactagttgatgatatca |
510 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596616 |
catgactatattggcgctatagcactgttgcatagcagaaacaaattaccattttccgcgatttgcaattggcaacactggtaactagttgatgatatca |
32596517 |
T |
|
| Q |
511 |
ttgatatggttagtatattgcttttgttagttattcttttttatttctt |
559 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596516 |
ttgatatggttagtatattgcttttgttagttattcttttttatttctt |
32596468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 32597027 - 32596972
Alignment:
| Q |
1 |
tgtcgttttgtcatgttcttctcttttgttttagttaccaaaaagcttgatctaaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32597027 |
tgtcgttttgtcatgttcttctctttcgttttagttaccaaaaagcttgatctaaa |
32596972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 353 - 410
Target Start/End: Original strand, 1310130 - 1310188
Alignment:
| Q |
353 |
aatttgatcaaattgctattgctccgtggtacattatttagtacaa-atattgtgaaat |
410 |
Q |
| |
|
||||||| ||||||||||||| ||| || |||| |||||||||||| |||||||||||| |
|
|
| T |
1310130 |
aatttgaacaaattgctattgttccttgatacactatttagtacaatatattgtgaaat |
1310188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 388 - 450
Target Start/End: Complemental strand, 41846809 - 41846746
Alignment:
| Q |
388 |
atttagtacaaa-tattgtgaaatcatgactatattggcgctatagcactgttgcatagcagaa |
450 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
41846809 |
atttagtacaaaatattgtgaaatggtgactatagcggcgctatagcactgctgcatagcagaa |
41846746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 446
Target Start/End: Complemental strand, 1912570 - 1912473
Alignment:
| Q |
350 |
cgaaatttgatcaaattgctattgctccgtggtacattatttagtacaaat-attgtgaaatcatgactatattggcgctatagcactgttgcatagc |
446 |
Q |
| |
|
|||||||||| ||||| ||||||| || | | || | |||||||||||||| ||||| |||| ||||||| || ||||||||||| |||||||||| |
|
|
| T |
1912570 |
cgaaatttgaacaaatcgctattgttctgcgatatactatttagtacaaattattgtcaaatagcgactatagtgacgctatagcaccgttgcatagc |
1912473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 422 - 450
Target Start/End: Complemental strand, 25981935 - 25981907
Alignment:
| Q |
422 |
tggcgctatagcactgttgcatagcagaa |
450 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25981935 |
tggcgctatagcactgttgcatagcagaa |
25981907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University