View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11529_low_12 (Length: 306)
Name: NF11529_low_12
Description: NF11529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11529_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 34591022 - 34590783
Alignment:
| Q |
18 |
gtttcttagatgaccatgcttagcaaattattcatacgatgttggatcttcactggagctgaatacaacaagattatggagagattgtgctttagtagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34591022 |
gtttcttagatgaccatgcttagcaaattattcatatgatgttggatcttcactggagctgaatacaacaagattatggagagattgtgctttagtagct |
34590923 |
T |
|
| Q |
118 |
tttgtagtgtcataatcatccagatatgcagggcttctgcttagccttttccccaaatcctaattttcatcattgctattttcagaatcagatactacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
34590922 |
tttgtagtgtcataatcatccagatatgcagggcttctgcttagccttttccccaaatcctaattttcatcattgctattttcagaatcagatgctataa |
34590823 |
T |
|
| Q |
218 |
cattttttgctcatcaatttcaggttgcctttcatcattt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34590822 |
cattttttgctcatcaatttcaggttgcctttcattattt |
34590783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 252 - 296
Target Start/End: Complemental strand, 34590767 - 34590723
Alignment:
| Q |
252 |
tcattttcactatgattgcttgcgttgtaggttaccttgtctgtg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34590767 |
tcattttcactatgattgcttgcgttgtaggttaccttgtttgtg |
34590723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University