View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11529_low_14 (Length: 273)
Name: NF11529_low_14
Description: NF11529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11529_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 262
Target Start/End: Complemental strand, 36550713 - 36550467
Alignment:
| Q |
16 |
tattcatcttgtcttttcttcttcttacaattagatctacatttttagagtaacaattattttgcttgaaaattaagggttaacttgacatctacacaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36550713 |
tattcatcttgtcttttcttcttcttataattagatctacatttttagagtaacaattattttgcttgaaaattaagggttaacttgacatctacacaca |
36550614 |
T |
 |
| Q |
116 |
atgagcaaaagaaagagtcgagggttggaattgaggcatccatcaccagaggaatcgaaatcatcgtcagttgatcacttgccggggttggtgtcaccat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36550613 |
atgagcaaaagaaagagtcgagggttggaattgaggcatccatcaccagaggaatcgaaatcatcgtcagttgatcacttgccggggttggtgtcaccat |
36550514 |
T |
 |
| Q |
216 |
gttcatcctcgtcttcaatatcatattcatcaaagatgactgttcat |
262 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36550513 |
gttcatcctcgtcttcaatatcaaattcatcaaagatgactgttcat |
36550467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University