View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11529_low_19 (Length: 244)
Name: NF11529_low_19
Description: NF11529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11529_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 2725589 - 2725370
Alignment:
| Q |
11 |
caaagggtaaaaaagcaccaaggtgaaatagcttaaatcatgtgacatgtgggggcattgtgtgattat--gtgtacatcaagcgtgcttttggttcatc |
108 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2725589 |
caaagggtaaaaaagcaccaatgtgaaatagcttacatcatgtaacatgtggggacattgtgtgattatatgtgtacatcaagcgtgcttttggttcatc |
2725490 |
T |
|
| Q |
109 |
acgttttaaccttttccttttgtctttcatacagtaactctagtagtaagtaatagtgctctctctactcaaaaatttggccagctggtttttcagtttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2725489 |
acgttttaaccttttccttttgtctttcatacagtaactctagtagtaagtaatagtgctttctctactcaaaaatttggccagctggtttttcagtctt |
2725390 |
T |
|
| Q |
209 |
tgagtaggacatttcaattc |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2725389 |
tgagtaggacatttcaattc |
2725370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University