View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11530_high_36 (Length: 280)
Name: NF11530_high_36
Description: NF11530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11530_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 23883226 - 23883475
Alignment:
| Q |
20 |
aactgctactatatatgcaaaacattacaatgacaattttggaaaatatcaactggcagcctccctaaaagtggttggattcgtttgatcaccgatggca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23883226 |
aactgctactatatatgcaaaacattacaatgacaattttggaaaatatcaactggcagcctccctaaaagtggttggattcgtttgatcaccgatggca |
23883325 |
T |
|
| Q |
120 |
catataaaggagggagtgttgcatggggagaatggcaaattgatcggtgtcttttggaagagattgcgggcaagtagcgcgtatgtggcagaactttgga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23883326 |
catataaaggagggagtgttgcatggggagaatggcaaattgatcagtgtcttttggaagagattgcgggcaagcagcgcgtatgtggcagaactttgga |
23883425 |
T |
|
| Q |
220 |
tagattttgaaggtttgaatttggctagtttccataagatcgagcttcat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23883426 |
tagattttgaaggtttgaatttggctagtttccataagatcgagcttcat |
23883475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 95 - 269
Target Start/End: Complemental strand, 23420007 - 23419834
Alignment:
| Q |
95 |
tggattcgtttgatcaccgatggcacatataaaggagggagtgttgcatggggagaatggcaaattgatcggtgtcttttggaagagattgcgggcaagt |
194 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||| | |||||||| || |||| |
|
|
| T |
23420007 |
tggatccgtttgatcacgg-tggcacatataaaggagggagtgttgcatggggagaatagcaaatggatctgtgtctttttggagagattgtggttaagt |
23419909 |
T |
|
| Q |
195 |
agcgcgtatgtggcagaactttggatagattttgaaggtttgaatttggctagtttccataagatcgagcttcat |
269 |
Q |
| |
|
|||||||| ||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23419908 |
agcgcgtaagtggcggaactttggatagtttttgaaggtttgaatttggctggtttccataagatcgagcttcat |
23419834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 245
Target Start/End: Original strand, 23876941 - 23877055
Alignment:
| Q |
132 |
ggagtgttgcatggggagaatggcaaatt-gatcggtgtcttttggaagagattgcgggcaagtagcgcgtatgtggcagaactttggatagattttgaa |
230 |
Q |
| |
|
||||||||||||||| |||||| || ||| |||| ||||||||| |||||||||| ||| ||||| |||||||||| ||||||| | || ||||||| |
|
|
| T |
23876941 |
ggagtgttgcatgggtagaatgacacatttgatctgtgtcttttcgaagagattgggggtgtgtagcacgtatgtggcggaacttttgggagtttttgaa |
23877040 |
T |
|
| Q |
231 |
ggtttgaatttggct |
245 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
23877041 |
ggttttaatttggct |
23877055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 143 - 245
Target Start/End: Complemental strand, 23422101 - 23421999
Alignment:
| Q |
143 |
tggggagaatggcaaattgatcggtgtcttttggaagagattgcgggcaagtagcgcgtatgtggcagaactttggatagattttgaaggtttgaatttg |
242 |
Q |
| |
|
|||| |||||||||||| |||| || |||||| ||| |||||| ||| |||| ||||||||||| ||||||| | | ||||||||||||||||||| |
|
|
| T |
23422101 |
tgggaagaatggcaaatggatctgtatcttttcgaaaagattgggggtgtgtagtgcgtatgtggcggaacttttgggaatttttgaaggtttgaatttg |
23422002 |
T |
|
| Q |
243 |
gct |
245 |
Q |
| |
|
||| |
|
|
| T |
23422001 |
gct |
23421999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University