View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11530_high_38 (Length: 259)
Name: NF11530_high_38
Description: NF11530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11530_high_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 43439282 - 43439039
Alignment:
| Q |
1 |
ttgtccataataacagcattttggtttaatagaaactgttgatcattgctaaaggggtgactaaaacttgtaccttcagctgaaggattttgaaggagta |
100 |
Q |
| |
|
|||||||||| || || |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43439282 |
ttgtccataacaagagtattttggtttgatagaaactgttgatcattgctaaaggggtgactaaaacttgtaccttcagctgcaggattttgaaggagta |
43439183 |
T |
|
| Q |
101 |
aacgattttcatgcaaaatatctgtaattgataaaggtcttgttgttgcatagttttgatcatctctgaaaaactgtggttgttgttgattactatacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43439182 |
aacgattttcatgcaaaatatctgtaattgataaaggtcttgttgttgcatagttttgatcatctctgaaatactgtggttgttgttgattactatacca |
43439083 |
T |
|
| Q |
201 |
tggttcataacctggcctgtgacttggacttggctttttaaatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439082 |
tggttcataacctggcctgtgacttggacttggctttttaaatg |
43439039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 200 - 242
Target Start/End: Original strand, 8724837 - 8724879
Alignment:
| Q |
200 |
atggttcataacctggcctgtgacttggacttggctttttaaa |
242 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
8724837 |
atggttcaaaacctggcctgtgacttggactaggctttttaaa |
8724879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University