View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11530_high_43 (Length: 247)
Name: NF11530_high_43
Description: NF11530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11530_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 43807046 - 43806827
Alignment:
| Q |
19 |
tcttggcgacactctttgagcattttggtgctcacttaaagnnnnnnnagaaaattgtctttcgtaatacttgcatgagtgaattatgagttcgaggatt |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43807046 |
tcttggcgacactctttgatcattttggtgctcacttaaagttttttgagaaaattgtctttcgtaatacttgcatgagtgaattatgagttcgaggact |
43806947 |
T |
|
| Q |
119 |
catcgttgatgttatcttcatttttgggctcattattaatccaacctaactaagatgaagataaatcttttttcaaaattctttgagaattcgggttgaa |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43806946 |
catcgttgatgttatcgtcatttttgggctcattattaacccaacctaactaagatgaagataaatcttttttcaaaattctttgagaattcgggttgaa |
43806847 |
T |
|
| Q |
219 |
aaagatcaaaaattgtcctt |
238 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
43806846 |
aaggatcaaaaattgtcctt |
43806827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University