View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11530_low_26 (Length: 343)
Name: NF11530_low_26
Description: NF11530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11530_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 19 - 334
Target Start/End: Complemental strand, 1367717 - 1367402
Alignment:
| Q |
19 |
aaatacattgaaaaattcatattcatattcatatatgaagatgaaatgcaaagaatgtgaactttgtaatcaacaagcttctttctattgtccttccgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1367717 |
aaatacattgaaaaattcatattcatattcatatatgaagatgaagtgcaaagaatgtgaactttgtaatcaacaagcttcgttctattgtccttccgat |
1367618 |
T |
 |
| Q |
119 |
tccgcttttctctgccggagttgcgacgacgccgttcacggcgctaacttcctcgtcgctcgtcacctccgtcacatcttgtgctccaaatgcgatggtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1367617 |
tccgcttttctctgccggagttgcgacgtcgccgttcacggcgctaacttcctcgtcgctcgtcacctccgtcacatcttgtgctccaaatgcgatggtt |
1367518 |
T |
 |
| Q |
219 |
tcaccgaaattcacatctccggcactacactccaccaccgtctttcatcaacctgccgttcttgctcgccggaaaatcattcctccggtgagccgagttc |
318 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1367517 |
tcaccgaaattctcatctccggcactgcacttcaccaccgtctttcatcaacctgccgttcttgctcgccggaaaatcaatcctccggtgagccgagttc |
1367418 |
T |
 |
| Q |
319 |
tcaatcttcttcatct |
334 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1367417 |
tcaatcttcttcatct |
1367402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University