View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11530_low_28 (Length: 336)
Name: NF11530_low_28
Description: NF11530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11530_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 314
Target Start/End: Complemental strand, 42674646 - 42674329
Alignment:
| Q |
20 |
gatatgcacactgtctttgtgattgcttttatgttttgttggtttgtgtgcttcttttatacaatgttgacaagaaggattaatcatttgaacaggacta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42674646 |
gatatgcacactgtctttgtgattgcttttatgttttgttggtttgtgtgcttcttttatacaatgttgacaagaaggattaatcatttgaacaggacta |
42674547 |
T |
 |
| Q |
120 |
ccccaccccatatggagggaacttgtgtgaaacataaaaaatgtatggctttcatctattttacattttcaataacaagc-------------------- |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42674546 |
ccccaccccatatggagggaacttgtgtgaaacataaaaagtgtatggctttcatctattttacattttcaataacaagcaattaaataaaaagaaaacc |
42674447 |
T |
 |
| Q |
200 |
-aactaatgaaaatttccctaatt--agttagtataacatacattcatacatacatattatagatctctgagtctttttagttctggcaaaatgacagaa |
296 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42674446 |
taactaatgaaaatttccctaattagagttagtataacatacattcatacatacatattatagatctctgagtctttttagttctggcaaaatgacagaa |
42674347 |
T |
 |
| Q |
297 |
gcaagacttggtctatcc |
314 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42674346 |
gcaagacttggtctatcc |
42674329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University