View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11530_low_42 (Length: 250)
Name: NF11530_low_42
Description: NF11530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11530_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 43439637 - 43439858
Alignment:
| Q |
22 |
gccaataagtaagatgatatggattcattatatcttagttttccatttcatcttactacaaaactaatttagaattttctgatattatatacatttttta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439637 |
gccaataagtaagatgatatggattcattatatcttagttttccatttcatcttactacaaagctaatttagaattttctgatattatatacatttttta |
43439736 |
T |
 |
| Q |
122 |
agtgataatggagattcacttgaagagtgacctaactccataatttgtttagagttcataattttctttctttcttttggattaccaattataagtttaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439737 |
agtgataatggagattcacttgaagagtgacctagctccataatttgtttagagttcataattttctttctttcttttggattaccaattataagtttaa |
43439836 |
T |
 |
| Q |
222 |
ctttgtactgtgtcctttgcta |
243 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
43439837 |
ctttgtactgtgtccttggcta |
43439858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University