View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11530_low_45 (Length: 247)

Name: NF11530_low_45
Description: NF11530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11530_low_45
NF11530_low_45
[»] chr2 (1 HSPs)
chr2 (19-238)||(43806827-43807046)


Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 43807046 - 43806827
Alignment:
19 tcttggcgacactctttgagcattttggtgctcacttaaagnnnnnnnagaaaattgtctttcgtaatacttgcatgagtgaattatgagttcgaggatt 118  Q
    ||||||||||||||||||| |||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||| |    
43807046 tcttggcgacactctttgatcattttggtgctcacttaaagttttttgagaaaattgtctttcgtaatacttgcatgagtgaattatgagttcgaggact 43806947  T
119 catcgttgatgttatcttcatttttgggctcattattaatccaacctaactaagatgaagataaatcttttttcaaaattctttgagaattcgggttgaa 218  Q
    |||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43806946 catcgttgatgttatcgtcatttttgggctcattattaacccaacctaactaagatgaagataaatcttttttcaaaattctttgagaattcgggttgaa 43806847  T
219 aaagatcaaaaattgtcctt 238  Q
    || |||||||||||||||||    
43806846 aaggatcaaaaattgtcctt 43806827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University