View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11530_low_47 (Length: 239)
Name: NF11530_low_47
Description: NF11530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11530_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 232
Target Start/End: Complemental strand, 38766964 - 38766749
Alignment:
| Q |
17 |
atatagattaatatcgctggaccgcaccaacggggcctaccgcccccatcaacaatatgtgggcctaatgcaggttttggccaaatacgcaagaggattg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
38766964 |
atatagattaatatcgctggaccgcaccaacagggcctaccgcccccatcaataatatgtgggcctaatgcaggttttggccaaatacgtaaggtaattg |
38766865 |
T |
|
| Q |
117 |
ttcttctttcatttgnnnnnnnncatgaacaatttaaattgggagaagagcaattatcaatacataaggagtaaaaggagcttcacaacgctccgctagc |
216 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| | ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38766864 |
ttcttctttcatttgtttttgttcatgaacaatttaaattagaagaagagcaattatcaatatataaggagtaaaatgagcttcacaacgctccgctagc |
38766765 |
T |
|
| Q |
217 |
tcaacttccgcctttg |
232 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
38766764 |
tcaacttccacctttg |
38766749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University