View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11531_low_10 (Length: 361)
Name: NF11531_low_10
Description: NF11531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11531_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 282 - 350
Target Start/End: Original strand, 45105476 - 45105544
Alignment:
| Q |
282 |
tgttacaataacatgatgataagaaaaaacaatatatttacttttgggtatatgtgatattgacttctt |
350 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45105476 |
tgttacgataacatgatgataagaaaaaacaatatatttacttttgggtatatgtgatattgacttctt |
45105544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 17 - 85
Target Start/End: Original strand, 45105202 - 45105270
Alignment:
| Q |
17 |
ataaatatgatatttaaaagtttaagtaaatcgtactgttactagaaatagtaaatgtccaccgtttac |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
45105202 |
ataaatatgatatttaaaagtttaagtaaatcgtactgttactagaaatagtaaaagtctaccgtttac |
45105270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 45105339 - 45105400
Alignment:
| Q |
151 |
aatggtgcactaagacgagaagcaaaccaacgtcaaacttagatgaaattgtgaacaagttt |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45105339 |
aatggtgcactaagacgagaagaaaaccaacgtcaaacttagatgaaattgtgaacaagttt |
45105400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University