View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11531_low_11 (Length: 246)
Name: NF11531_low_11
Description: NF11531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11531_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 46443287 - 46443180
Alignment:
| Q |
7 |
gattcttatgaattgttatgaaagcctggctgtgatctgtggtaaacagagcaattttcgtttttgttgacaagggcaaaagtggaaaacctcatctctc |
106 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46443287 |
gattgttatgaattgtcatgaaagcctggctgtgatttgtggtaaacagagcaattttcgtttttgttgacaagggcaaaagtggaaaacctcatctctc |
46443188 |
T |
 |
| Q |
107 |
tactcctt |
114 |
Q |
| |
|
||| |||| |
|
|
| T |
46443187 |
tacccctt |
46443180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University