View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11531_low_14 (Length: 238)
Name: NF11531_low_14
Description: NF11531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11531_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46337608 - 46337386
Alignment:
| Q |
1 |
aatacatatgttaaaaataatgatttgcatgttaaattaaaatcaactcttaactctatgactctcctttatggaaagatttaacaagtatttgggatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46337608 |
aatacatatgttaaaaataatgatttgcatgttaaattaaaatcaactcttaactctatgactctcctttatggaaagatttaacaagtatttgggatca |
46337509 |
T |
|
| Q |
101 |
gtttcaaaatcatattgtgtagcagttgtgatatttgaatcatattagcttttggatggttaagtggaatccttgtagagcttctctcatgttaacttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46337508 |
gtttcaaaatcatattgtgtagcagttgtgatatttgaatcatattagcttttggatggttaagtggaatccttgtagagcttctctcatgttaacttat |
46337409 |
T |
|
| Q |
201 |
attcgaccttcgattgataatac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46337408 |
attcgaccttcgattgataatac |
46337386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 97
Target Start/End: Original strand, 38061702 - 38061742
Alignment:
| Q |
57 |
tatgactctcctttatggaaagatttaacaagtatttggga |
97 |
Q |
| |
|
||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
38061702 |
tatgattctcctttatggaaagctttaacatgtatttggga |
38061742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University