View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11532_high_13 (Length: 246)
Name: NF11532_high_13
Description: NF11532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11532_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 32414028 - 32414120
Alignment:
| Q |
1 |
agcaggattcttcttgattgtaacggtggttgatacaacattgttctgttctccctcctaagtaaaaacagtcatttggtcttgcttgtgtaa |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32414028 |
agcaggattcttcttgattgtaacggtggttgatacaacattgttctgttctccctcctaagtaaaaacagtcatttggtcttgcttgtgtaa |
32414120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 123 - 232
Target Start/End: Original strand, 32414118 - 32414229
Alignment:
| Q |
123 |
taataatgcatccaaattgaaaacacatctctaatggtctctttaattagtcatgttggtctctaaatatg--nnnnnnngttagtagttttgctcttca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
32414118 |
taataatgcatccaaattgaaaacacatctctaatggtctctttaattagtcatgttggtcactaaatatgttttttttttttagtcgttttgctcttca |
32414217 |
T |
|
| Q |
221 |
aatatgtttttg |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32414218 |
aatatgtttttg |
32414229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University