View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11532_high_15 (Length: 237)
Name: NF11532_high_15
Description: NF11532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11532_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 40077143 - 40076941
Alignment:
| Q |
17 |
cataggatacttggcccaataagtgtccatttttgggtgcaacaatgcattgttgtagattatgtcgtggttgtgtatacgacaataatcaaccttgttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40077143 |
cataggatacttggcccaataagtgtccattttcgggtccaacaatgcattgttgtagattatgtcgtggttgtgtatacgacaataatcaaccttgttt |
40077044 |
T |
|
| Q |
117 |
ttaaagaaccgcagtaaaaggtggtcgccaatcgggttgtcacactttgtaggttgtgaaccggttataacaagtatcttttcgcttgctccgaccacga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40077043 |
ttaaagaaccgcagtaaaaggtggtcgccaatcgggttgtcacactttgtaggttgtgaacccgttataacaagtatcttttcgcttgctccgaccacga |
40076944 |
T |
|
| Q |
217 |
atg |
219 |
Q |
| |
|
||| |
|
|
| T |
40076943 |
atg |
40076941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University