View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11532_high_5 (Length: 402)
Name: NF11532_high_5
Description: NF11532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11532_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 383
Target Start/End: Complemental strand, 55572747 - 55572370
Alignment:
| Q |
1 |
tttcacggttttttgtaataagatggatgagaaggattaggttgtttagcagcataaagatgaattgaaaggaaaaagtttcaggggtgactcgtgagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572747 |
tttcacggttttttgtaataagatggatgagaaggattaggttgtttagcagcataaagatgaattgaaaggaaaaagtttcaggggtgactcgtgagtg |
55572648 |
T |
|
| Q |
101 |
cttggttcaaaagtaaacttatcatattagccatagagagnnnnnnnggtgtttttggtgtatttaattgagctaccttccttgcttctgttctgttctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572647 |
cttggttcaaaagtaaacttatcatattagccatagagagaaaaaaaggtgtttttggtgtatttaattgagctaccttccttgcttctgttctgtt--- |
55572551 |
T |
|
| Q |
201 |
tttaggtttcttttcttgcatgcatcataatcaatcaatgttaagtagtggccacagtgcaaagctttgtagatttgagctttacattcagctcctccaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55572550 |
--taggtttcttttcttgcatgcatcataatcaatcaatgttaagtagtggccacagtgcaaagctttgtagatttgagctttgcattcagctcctccaa |
55572453 |
T |
|
| Q |
301 |
caatttgcacttttctacaaatttgggatatgtaccatatcccatctatttactgtagcaaacaccacatcgttgggaccaaa |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572452 |
caatttgcacttttctacaaatttgggatatgtaccatatcccatctatttactgtagcaaacaccacatcgttgggaccaaa |
55572370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University