View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11532_high_8 (Length: 307)
Name: NF11532_high_8
Description: NF11532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11532_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 300
Target Start/End: Original strand, 32016614 - 32016906
Alignment:
| Q |
18 |
gttgttaattttagaggatggtttgaatcctgtggaggaaaaggtgtttgattacttttggaaaagcccggccccgtcaaaagttgtggctttttcttg- |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32016614 |
gttgttaattttagaggatggtttgaatccggtggaggaagaggtgtttggttacctttggaaaagcccagccccgtcaaaagttgtggctttttcttgg |
32016713 |
T |
 |
| Q |
117 |
---------cgtgatcggattcctacgggaggaatcttgccattcagaatttattggacccgaaaagttcgaccaattgtgttttttgcgatgcttaggt |
207 |
Q |
| |
|
||| ||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32016714 |
aaacttcttcgtaatcggattcctacaggagaaatcttgccattcagaatttattggatccgaaaagttcgaccaattgtgttttttgcgatgcttcggt |
32016813 |
T |
 |
| Q |
208 |
agaatcttcaacgcatcttttcttgcattgtagtgttatttctaagaattggaggaaaatcatgggattgactttggagaaaaatcatggatt |
300 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32016814 |
agaatcttcaacacatattttcttgcattgtagtgttatttctaagaattggaggaaaatcatgggattgactttggagaaaaatcatggatt |
32016906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 74 - 117
Target Start/End: Original strand, 7425062 - 7425105
Alignment:
| Q |
74 |
tttggaaaagcccggccccgtcaaaagttgtggctttttcttgc |
117 |
Q |
| |
|
||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
7425062 |
tttggaagagcccggctcggtcaaaagttgtggctttttcttgc |
7425105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University