View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11533_high_3 (Length: 423)
Name: NF11533_high_3
Description: NF11533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11533_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 223 - 408
Target Start/End: Complemental strand, 3295156 - 3294966
Alignment:
| Q |
223 |
attaggatagcgtggtactcttatatttgtaagg-acaaaggtaaatgtgtggctgaattgatcgtatgt----caatagttttgatgagagaataattt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3295156 |
attaggatagcgtggtactcttatatttgtaagggacaaaggtaaatgtgtggctgaattgatcgtatgtatgtcaatagttttgatgagagaataattt |
3295057 |
T |
|
| Q |
318 |
gatttaaaagtctaaacacaagacacctgaaatgactagaattagggaattctcacatataggtcaaacacgcaaggtttattgaaggttt |
408 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
3295056 |
gatttaaaagcctaaacacaaggcacctgaaatgactagaattaaagaattctcacctatagctcaaacacgcaaggtttattgaaggttt |
3294966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 3295270 - 3295154
Alignment:
| Q |
1 |
caattataatccctataattc-gcatctttagtgcatgcaccatttctctcgctctaaactttgtttcacaatccaaccgttgaaagtgaatacccgcat |
99 |
Q |
| |
|
|||||||||||||||||| || ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3295270 |
caattataatccctataaatccgcagcttcagtgcatgcaccatttctctcgctctaaactttgtttcacaatccaaccgttgaaaatgaatacccgcat |
3295171 |
T |
|
| Q |
100 |
agggtccaaaagtgatt |
116 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3295170 |
agggtccaaaagtgatt |
3295154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University