View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11533_low_6 (Length: 350)
Name: NF11533_low_6
Description: NF11533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11533_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 92 - 207
Target Start/End: Complemental strand, 11582858 - 11582741
Alignment:
| Q |
92 |
atatatagtatatcatttcatgccatttatata--aatgttgcctttaaattcaaaccgttaaataattttacatcacagatttcatatacttgatctat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11582858 |
atatatagtatatcatttcatgccatttatatataaatgttgcctttaaattcaaaccgttaaataattttacatcacatatttcatatacttgatctag |
11582759 |
T |
|
| Q |
190 |
cgttattgataagcaaac |
207 |
Q |
| |
|
| ||||| |||||||||| |
|
|
| T |
11582758 |
ctttattcataagcaaac |
11582741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 17 - 79
Target Start/End: Complemental strand, 11583833 - 11583771
Alignment:
| Q |
17 |
aagaagaaatagaacaaaaaagctgattgctactgtgacaaaataaacaagcacagtgagtga |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11583833 |
aagaagaaatagaacaaaaaagctgattgctactgtgacaaaataaacaagcacaatgagtga |
11583771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University