View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11534_high_13 (Length: 323)
Name: NF11534_high_13
Description: NF11534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11534_high_13 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 46870464 - 46870619
Alignment:
| Q |
168 |
aagaagtattcaaggtcaccaaccacttctcaagttggagattcttccactttttctttgtattgatgatgagaaaccaagaagcagagtatactctgtt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46870464 |
aagaagtattcaaggtcaccaaccacttctcaagttggagattcttccactttttctttgtattgatgatgagaaaccaagaagcagagtatactctgtt |
46870563 |
T |
|
| Q |
268 |
tgaggcagaggatactctgttttggttagaataaaaagttaattgtttttagccac |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46870564 |
tgaggcagaggatactctgttttggttagaataaaaagttaattgtttttagccac |
46870619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 46870297 - 46870430
Alignment:
| Q |
1 |
gtggaggtaaaaagcaatgggatatggatgaagctgtgaaagctcacatgtcattttgcagaaaattcaaatctaaccctgcagttagagtagcagaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46870297 |
gtggaggtaaaaagcaatgggatatggatgaagctgtgaaagctcacatgtcattttgcagaaaattcaaatctaaccctgcagttagagtagcagaagg |
46870396 |
T |
|
| Q |
101 |
tatgagacagatgctaagaagaagatcaaatgat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46870397 |
tatgagacagatgctaagaagaagatcaaatgat |
46870430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University