View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11534_high_15 (Length: 243)

Name: NF11534_high_15
Description: NF11534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11534_high_15
NF11534_high_15
[»] chr4 (1 HSPs)
chr4 (116-210)||(35279508-35279602)


Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 116 - 210
Target Start/End: Complemental strand, 35279602 - 35279508
Alignment:
116 ggttacccgccactataaattctagctagttaatttcttatgattcattctctttcaaaaatataaccaatttcttcactttcatcatccattaa 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35279602 ggttacccgccactataaattctagctagttaatttcttatgattcattctctttcaaaaatataaccaatttcttcactttcatcatccattaa 35279508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University