View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11534_high_16 (Length: 240)
Name: NF11534_high_16
Description: NF11534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11534_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 18 - 142
Target Start/End: Complemental strand, 5969390 - 5969266
Alignment:
| Q |
18 |
agttgttagtttttcacaccggatagtgttagtacaaatgttaggtgaaaagcttaattgatgtgttactttggtctcacccattttcctacgctaaaat |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5969390 |
agttgttagttttttacaccggatagtgttagtacaaatgttaggtgaaaagctgaattgatatgttactttggtctcacccattttcctaccctaaaat |
5969291 |
T |
|
| Q |
118 |
taaaatttcttaggcttccatggca |
142 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5969290 |
taaaatttcttaggcttccatggca |
5969266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 173 - 240
Target Start/End: Complemental strand, 5969268 - 5969201
Alignment:
| Q |
173 |
gcactatagattgtcccaaaactgtaacgcaggctaatagtcaaagttaggcatgtgatttctaatat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5969268 |
gcactatagattgtcccaaaactgtaacgcaggctaatagtcaaagttaggcatgtgatttctaatat |
5969201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University