View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11534_low_17 (Length: 229)
Name: NF11534_low_17
Description: NF11534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11534_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 37504146 - 37504297
Alignment:
| Q |
1 |
cctcttgaaattcacctagacaaacagaacactctgtcccatcaacgagtccttcgtcttttccgtatttgaagactgtaatggaatctatcaccgatcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37504146 |
cctcttgaaattcacctagacaaacagaacactctgtcccatcaacgagtccttcgtcttttctgtatttgaagactgtaatggaatctatcaccgatcg |
37504245 |
T |
 |
| Q |
101 |
ttgaagccctacagtacggataaaccatatgggatgatcaacaataaccctc |
152 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37504246 |
ttgaagccctaccgtacggatgaaccatatgggatgatcaacaataaccctc |
37504297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 184 - 229
Target Start/End: Original strand, 37504329 - 37504374
Alignment:
| Q |
184 |
ttgaaattgtagaatctctataaccatggacatcaaacaataccgg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37504329 |
ttgaaattgtagaatctctataaccatggacatcaaacaataccgg |
37504374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University