View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11534_low_9 (Length: 386)
Name: NF11534_low_9
Description: NF11534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11534_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 21 - 365
Target Start/End: Complemental strand, 36949307 - 36948963
Alignment:
| Q |
21 |
cactgaaccgccgctcaccgccatcccgctctctccaatgccgccctgcaccgccactctcacaggctgaaaatcgtgctctccattttatgcagaaata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36949307 |
cactgaaccgccgctcaccgccatcccgctctctccaatgccgccctgcaccaccactctcacaggctgaaaattgtgctctccattttatgcagaaata |
36949208 |
T |
|
| Q |
121 |
aatattgcagcttctgttttcctatattttttaataacgatcaatgagaaataaatgtacagaaatcaattgtgattgtttttcatgctttttgttaaca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
36949207 |
aatattgcagcttctgttttcctatattttttaataacgatcaatgagaaataaatgtacagaaatcaattgtgactttttttcatgctttttgttaaca |
36949108 |
T |
|
| Q |
221 |
atccatgagaagtaaactttaattttgaagagaagtagaactcgtgaatcaaaggaattgattggtaatagcggcgtgctgggggtagaagaagagccga |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36949107 |
atccatgagaagtaaactttaattttgaagagaagtagaactcgtgaatcaaaggaattgattggtaatggcggcgtgctgggggtagaagaagagccga |
36949008 |
T |
|
| Q |
321 |
gggataactgttcctttttcattattataaaaacttcaattttga |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36949007 |
gggataactgttcctttttcattattataaaaactttaattttga |
36948963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University