View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11535_high_10 (Length: 250)

Name: NF11535_high_10
Description: NF11535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11535_high_10
NF11535_high_10
[»] chr5 (1 HSPs)
chr5 (9-250)||(2177183-2177423)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 2177423 - 2177183
Alignment:
9 agcagagacatgtatgacttttctcttccttgacccctaggtcacttcattgatattgagcagnnnnnnnttcaggtaattagtccatgaccctttgtgc 108  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||    
2177423 agcaaagacatgtatgacttttctcttccttgacccctaggtcacttcattgatattgagcagaaaaaaattcaggtaattagtccatgaccctttgtgc 2177324  T
109 cccgccaccctagacatatcgatcatatgcttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccatattttt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2177323 cccgccaccctagacatatcgatcatatgcttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccatattttt 2177224  T
209 cctcaccctttcttttccttcccacttcttttcttctagtac 250  Q
    |||||||| |||||||||||||||||||||||||||||||||    
2177223 cctcaccc-ttcttttccttcccacttcttttcttctagtac 2177183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University