View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11535_high_16 (Length: 213)
Name: NF11535_high_16
Description: NF11535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11535_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 51553184 - 51553001
Alignment:
| Q |
13 |
agatgaaatcgattgttcctgttatgatgcagctacggaagaattgtctatgtgctactgtgtatagcgtgtcttggaagccttcaaaacggcagttggc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51553184 |
agatgaaatcgattgttcctgttatgatgcagctacggaagaattgtctatgtgccactgtgtatagcgtgtcttggaagccttcaaaacggcagttggc |
51553085 |
T |
 |
| Q |
113 |
aaacacagcacgatctgcttggactctagctgctactgcttgatgtccttcaggaccagctgtgtttctgaatcccattgctag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51553084 |
aaacacagcacgatctgcttggactctagctgctactgcttgatgtccttcaggaccagctgtgtttctgaatcccattgctag |
51553001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University