View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11535_high_2 (Length: 568)
Name: NF11535_high_2
Description: NF11535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11535_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 473; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 473; E-Value: 0
Query Start/End: Original strand, 20 - 555
Target Start/End: Complemental strand, 2097578 - 2097043
Alignment:
| Q |
20 |
atactcaatttgaccttatggctcattgttttctttgttattctttacattaactatcaaaatcaaaacctatttgtagctgcacctcgtgacgaggaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097578 |
atactcaatttgaccttatggctcattgttttctttgttattctttacattaactatcaaaatcaaaacctatttgtagctgcacctcgtgacgaggaag |
2097479 |
T |
 |
| Q |
120 |
ctgcaactcttgccgaggcagtggcatctggcagcaagctggaagtagaagtaggtttacagaagtttgatgtcaatgggagcagccgtgagctgggttg |
219 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2097478 |
ctgcaactcttgccgaggtagtggcatctggcagcaagctggaagtagaagtaggtttacagaagtttgatgtcaatgggagcagccgtgacctgggttg |
2097379 |
T |
 |
| Q |
220 |
gatcagcgacccaggctttgacaccgatggcgaaagcagggttgattgatttggaggagaacatggagacggatgctagctagaaatagagtcaattctg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2097378 |
gatcagcgacccaggctttgacaccgatggcgaaagcagggttgattgatttggaggagaacatggagacagatgctagctagaaatagagtcaattctg |
2097279 |
T |
 |
| Q |
320 |
aagattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttgaggnnnnnnnnacgagttttaggtctaagaaaaaccaaggtttggtctg |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
2097278 |
aagattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttga-gttttttttacgagtcttaggtctaagaaaaaccaaagtttggtctg |
2097180 |
T |
 |
| Q |
420 |
gc-tttagtttggcacgttgttgtgtggaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggttct |
518 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097179 |
gcttttagtttggcacgttgttgtgtgaaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggttct |
2097080 |
T |
 |
| Q |
519 |
ctctgatgttgggggttctgtggggggtttctctgct |
555 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097079 |
ctctgatgttgggggttctgtggggggtttctctgct |
2097043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University