View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11535_low_10 (Length: 250)
Name: NF11535_low_10
Description: NF11535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11535_low_10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 2177423 - 2177183
Alignment:
| Q |
9 |
agcagagacatgtatgacttttctcttccttgacccctaggtcacttcattgatattgagcagnnnnnnnttcaggtaattagtccatgaccctttgtgc |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2177423 |
agcaaagacatgtatgacttttctcttccttgacccctaggtcacttcattgatattgagcagaaaaaaattcaggtaattagtccatgaccctttgtgc |
2177324 |
T |
|
| Q |
109 |
cccgccaccctagacatatcgatcatatgcttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccatattttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177323 |
cccgccaccctagacatatcgatcatatgcttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccatattttt |
2177224 |
T |
|
| Q |
209 |
cctcaccctttcttttccttcccacttcttttcttctagtac |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2177223 |
cctcaccc-ttcttttccttcccacttcttttcttctagtac |
2177183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University