View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11535_low_12 (Length: 246)
Name: NF11535_low_12
Description: NF11535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11535_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 72 - 179
Target Start/End: Complemental strand, 24727914 - 24727807
Alignment:
| Q |
72 |
aattggaagttcaatgtaaaaacaaaatcgtattaaagaaagaagaaactttatcaaagaatggaggattgtcaaataaggtaaataagctaaacttgaa |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24727914 |
aattggaagttcaatgtaaaaacaaaatcgtattaaagaaagaagaaactttatcaaagaatggaggattgtcaaataaggtaaataagctaaacttgaa |
24727815 |
T |
|
| Q |
172 |
ttaaatga |
179 |
Q |
| |
|
|||||||| |
|
|
| T |
24727814 |
ttaaatga |
24727807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 24688430 - 24688371
Alignment:
| Q |
21 |
aaatgattgtaattgcaagccagcccagaaatttatatctcaactaaattaaattggaag |
80 |
Q |
| |
|
|||||| ||||| ||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24688430 |
aaatgaatgtaaatgcaacccaacccagaaatttatatctcaactaaattaaattggaag |
24688371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University