View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11535_low_14 (Length: 242)
Name: NF11535_low_14
Description: NF11535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11535_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 44730415 - 44730175
Alignment:
| Q |
18 |
agtccaccattatattcttcacaagatggagcggtttaacaaacatcacttctcattgcatacattaccttgttttaca----------------tcaac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44730415 |
agtccaccattatattcttcacaagatggagcggtttaacaaacatcacttctcattgcatacattaccttgttttacacaccttttgtctcacatcaac |
44730316 |
T |
 |
| Q |
102 |
accttgtattgactcataacaatatcctcttatgggaaaccatatctcatttcatgccacaaccaaaatcatttactatgatggttcagttcaagaattt |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44730315 |
accttgtattggctcataacaatatcctcttatgggaaaccatatctcatttcatgccacaaccaaaatcatttactatgatggttcagttcaagaattt |
44730216 |
T |
 |
| Q |
202 |
gatcaaccaataacagtagcagagcttatgttagatcaccc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44730215 |
gatcaaccaataacagtagcagagcttatgttagatcaccc |
44730175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 39083839 - 39083883
Alignment:
| Q |
181 |
gatggttcagttcaagaatttgatcaaccaataacagtagcagag |
225 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||||||| |||||| |
|
|
| T |
39083839 |
gatggttcagttcatgaatttgatgaagcaataacagtggcagag |
39083883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University