View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11535_low_14 (Length: 242)

Name: NF11535_low_14
Description: NF11535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11535_low_14
NF11535_low_14
[»] chr7 (1 HSPs)
chr7 (18-242)||(44730175-44730415)
[»] chr1 (1 HSPs)
chr1 (181-225)||(39083839-39083883)


Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 44730415 - 44730175
Alignment:
18 agtccaccattatattcttcacaagatggagcggtttaacaaacatcacttctcattgcatacattaccttgttttaca----------------tcaac 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                |||||    
44730415 agtccaccattatattcttcacaagatggagcggtttaacaaacatcacttctcattgcatacattaccttgttttacacaccttttgtctcacatcaac 44730316  T
102 accttgtattgactcataacaatatcctcttatgggaaaccatatctcatttcatgccacaaccaaaatcatttactatgatggttcagttcaagaattt 201  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44730315 accttgtattggctcataacaatatcctcttatgggaaaccatatctcatttcatgccacaaccaaaatcatttactatgatggttcagttcaagaattt 44730216  T
202 gatcaaccaataacagtagcagagcttatgttagatcaccc 242  Q
    |||||||||||||||||||||||||||||||||||||||||    
44730215 gatcaaccaataacagtagcagagcttatgttagatcaccc 44730175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 39083839 - 39083883
Alignment:
181 gatggttcagttcaagaatttgatcaaccaataacagtagcagag 225  Q
    |||||||||||||| ||||||||| || |||||||||| ||||||    
39083839 gatggttcagttcatgaatttgatgaagcaataacagtggcagag 39083883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University