View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11535_low_19 (Length: 213)

Name: NF11535_low_19
Description: NF11535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11535_low_19
NF11535_low_19
[»] chr4 (1 HSPs)
chr4 (13-196)||(51553001-51553184)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 51553184 - 51553001
Alignment:
13 agatgaaatcgattgttcctgttatgatgcagctacggaagaattgtctatgtgctactgtgtatagcgtgtcttggaagccttcaaaacggcagttggc 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
51553184 agatgaaatcgattgttcctgttatgatgcagctacggaagaattgtctatgtgccactgtgtatagcgtgtcttggaagccttcaaaacggcagttggc 51553085  T
113 aaacacagcacgatctgcttggactctagctgctactgcttgatgtccttcaggaccagctgtgtttctgaatcccattgctag 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51553084 aaacacagcacgatctgcttggactctagctgctactgcttgatgtccttcaggaccagctgtgtttctgaatcccattgctag 51553001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University