View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11536_high_14 (Length: 263)
Name: NF11536_high_14
Description: NF11536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11536_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 64 - 246
Target Start/End: Complemental strand, 42801004 - 42800819
Alignment:
| Q |
64 |
gcatgagtttcatgaatttaaccaccgtcactgctttcatcttcaactaacccctttcccaagtttcattaatcctcctaattttcttcattccttttta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42801004 |
gcatgagtttcatgaatttaaccaccgtcactgctttcatcttcaactaacccctttcccaagtttcattaatcctcctaattttcttcattccttttta |
42800905 |
T |
 |
| Q |
164 |
t---tacttaccatctttatcttaatttaatttcatcattcagataacccaaatcttctccttcaagataacaaaaacgctttttt |
246 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800904 |
ttactacttcccatctttatcttaatttaatttcatcattcagataacccaaatcttctccttcaagataacaaaaacgctttttt |
42800819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University