View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11536_low_11 (Length: 302)
Name: NF11536_low_11
Description: NF11536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11536_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 283
Target Start/End: Complemental strand, 35491423 - 35491169
Alignment:
| Q |
11 |
cacagataatcaaaatactaaaataatatgtattgttgaaggaattgtttgttttagttttgacttcttctctcatcttatcttattagcaactgttgat |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35491423 |
cacaggtaatcaaaatactaaaataatatgtactgttgaaggaattatttgttttagttttgacttcttctctcatcttatcttattagcaactgttgat |
35491324 |
T |
 |
| Q |
111 |
gttagaaaacagtcataattttggacatataacatttatagaaataaacttgagcacaagtgtatatcatcgacatgtatgcctaaaccttaagatac-- |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35491323 |
gttagaaaacagtcataattttggacatataacatttatagaaataaacttgagcacaagtgtat--------------------aaccttaagatacgt |
35491244 |
T |
 |
| Q |
209 |
acacatttgagagatgggtgctggagtattagtttcttcaacaaatggaaggcaatatgaggggaaggtcacacc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35491243 |
acacatttgagagatgggtgctggagtattagtttcttcaacaaatggaaggcaatatgaggggaaggtcacacc |
35491169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University