View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11536_low_18 (Length: 242)
Name: NF11536_low_18
Description: NF11536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11536_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 15154170 - 15153946
Alignment:
| Q |
1 |
tgcctccgtgaatgattgtttcacttgtacggtggtttccgttcattgtgggcatcttgcacgacggaacgatgataggaaacgaccgaaacattgaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15154170 |
tgcctccgtgaatgattgtttcacttgtacggtggtttccgttcatcgtgggcagcttgcacgacggaacgatgataggaaacgaccgaaacattgaacg |
15154071 |
T |
|
| Q |
101 |
aaatttgccaaagaatttgttggtggaactgcgtttgctcttgctgtttgctggctgtaaggaaatttgcatgggaactttcggtgaagtgatcgccggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15154070 |
aaatttgccaaagaatttgttggtggaactacgtttgcttttgctgtttgccggctgtaaggaaatttgcatgggaactttcggtgaagtgatcgcgggc |
15153971 |
T |
|
| Q |
201 |
agtggtcgttgtgccgtcggtaatg |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
15153970 |
ggtggtcgttgtgccgtcggtaatg |
15153946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 15149770 - 15149596
Alignment:
| Q |
12 |
atgattgtttcacttgtacggtggtttccgttcattgtgggcatcttgcacgacggaacgatgataggaaacgaccgaaacattgaacgaaatttgccaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||| |||||||||| |
|
|
| T |
15149770 |
atgattgtttcacttgtacggtggtttccgttcattgtgggcatcttgcacgacggaacaatgatcggaaacgaccggaacattgaacggaatttgccaa |
15149671 |
T |
|
| Q |
112 |
agaatttgttggtggaactgcgtttgctcttgctgtttgctggctgtaaggaaatttgcatgggaactttcggtg |
186 |
Q |
| |
|
| | ||||||||||||| | ||||||| ||||||||||| ||||||||| ||| ||||| ||||| |||||| |
|
|
| T |
15149670 |
atagtttgttggtggaattttgtttgcttttgctgtttgccggctgtaagttaatcggcatgcgaactgtcggtg |
15149596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University