View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_high_58 (Length: 251)
Name: NF11537_high_58
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_high_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 24219583 - 24219343
Alignment:
| Q |
1 |
attacggtagcagctacatgataaatctctgcattgttaaatgatgtatatgtggcgtatatagctgtaatgagaaccataatgcagttctttacaccgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24219583 |
attacggtagcagctacatgataaatctctgcattgttaaatgatgtatatgtggcgtatatagctgtaatgagaaccataatgcagttatttacaccgt |
24219484 |
T |
 |
| Q |
101 |
tcaaatatttatgttacaatacaattgcaaattgtaatttagaattcggaattgattttaaaattaccagaaatgctcaatatagcaaaaattatatcac |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24219483 |
tcaaatatttatgttacgatacaattgcaaattgtaatttagaattcggaattgattttaaaattaccagaaatgctcaatatagcaaaaattatatcac |
24219384 |
T |
 |
| Q |
201 |
gaacgcatcataatactatgtggtatcgcaacttgcctatg |
241 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24219383 |
gcacgcatcataatactatgtggtatcgcaacttgcctatg |
24219343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University