View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_high_59 (Length: 251)
Name: NF11537_high_59
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_high_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 8889641 - 8889424
Alignment:
| Q |
15 |
atgaaacatgagaaccagcatcagcagctttaagaaaataatcatcaagctccttaataacttcaaccagatctttactgtttcttgaaaccaccattgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8889641 |
atgaaacatgagaaccagcatcagcagctttaagaaaataatcatcaagctccttaataacttcaaccagatctttactgtttcttgaaaccaccattgc |
8889542 |
T |
|
| Q |
115 |
aagttcacttcctgactccttagaataccccaccaccccactcgccggagtagccatactcgccgccgcaccaccagtcatcacaaccacctcagagcca |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8889541 |
aagttcacttcctgacaccttagaataccccaccaccccactcgccggagtagccatactcgccgccgccccaccagccatcacaaccacctcagagcca |
8889442 |
T |
|
| Q |
215 |
gtggtcgcagtagcttcc |
232 |
Q |
| |
|
||||| | || ||||||| |
|
|
| T |
8889441 |
gtggtagtagcagcttcc |
8889424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University