View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_high_75 (Length: 228)
Name: NF11537_high_75
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_high_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 38616057 - 38615856
Alignment:
| Q |
9 |
gagtagcaaaggctttacaatgagaaggtacctaacagaaattgatgtttttcaccgcaccattaaggggttagtattcttcaaacttaaacatttttgt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38616057 |
gagttgcaaaggctttacaatgagaaggtacctaacagaaattgatgtttttcaccgcaccattaaggggttagtattcttcaaacttaaacatttttgt |
38615958 |
T |
 |
| Q |
109 |
gattattgtagaatgaaagactacagcaagtggagaaatacatagacaaaatacacagcttgtccacaatcttgggaaaggattcctcttcaatcattct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38615957 |
gattattgtagaatgaaagactacagcaagtggagaaatacatagacaaaatacacagcttgtccacaatcttgggaaaggattcctcttcaatcattct |
38615858 |
T |
 |
| Q |
209 |
tc |
210 |
Q |
| |
|
|| |
|
|
| T |
38615857 |
tc |
38615856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University