View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_high_82 (Length: 201)
Name: NF11537_high_82
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_high_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 5 - 179
Target Start/End: Original strand, 2387234 - 2387408
Alignment:
| Q |
5 |
atgcggacacgatatgatatagtagcacagactcgaacgcggacacgatatgatacagtctttgcttagagaaattgaatagtagtaaaatgaaaagtta |
104 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2387234 |
atgcggacacaatatgatacagtagcacagactcggacgcggacacgatatgatacagtctttgcttagagaaattgaatagtagtaaaatgaaaagtta |
2387333 |
T |
 |
| Q |
105 |
tggtaaaatttttcttctgtagattacatgnnnnnnngtttcatattcttttttaatcaaaatttaggtggatat |
179 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2387334 |
tggtaaaaattttcttctgtagattacatgaaaaaaagtttcatattcttttttaatcaaaatttaggtggatat |
2387408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University