View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_13 (Length: 517)
Name: NF11537_low_13
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 9e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 9e-99
Query Start/End: Original strand, 222 - 500
Target Start/End: Original strand, 8087450 - 8087747
Alignment:
| Q |
222 |
aattgacaatgatgctccaactcagagtgcttcctgatttactcaaggttctcaattttcactaccacctgatatcatgtccatagttacatttttgagn |
321 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8087450 |
aattgataatgatgctccaactcagagtgcttcctgatttactcaaggttctcaattttcacaaccacctaatatcatgtccatagttacatttctgagt |
8087549 |
T |
|
| Q |
322 |
nnnnnncttcagaaatcaataaaatccagaatgtatgtatcgttgttgctaatttc-------------------atacattgtatatcattcaatttct |
402 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
8087550 |
ttttttcttcagaaataaataaaatccagaatgtatgtatcgttgttactaatttcatacatcattgtttaatttatacattatatatcattcaatttct |
8087649 |
T |
|
| Q |
403 |
actattgttgaacatatcatttcttaatttgtttattatttcaggaaaccatctatgtcactattgcagagataaaaaattgaatgccacccgatatg |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8087650 |
actattgttgaacatatcatttcttaatttgtttattatttcacgaaaccatctatgtcactattgcagagataaaaaattgaatgccacccgatatg |
8087747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 171 - 199
Target Start/End: Complemental strand, 8084654 - 8084626
Alignment:
| Q |
171 |
atccaatttaatctttctcattcactttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8084654 |
atccaatttaatctttctcattcactttt |
8084626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University