View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_18 (Length: 457)
Name: NF11537_low_18
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 1 - 439
Target Start/End: Original strand, 24219751 - 24220189
Alignment:
| Q |
1 |
tgttgttagtatcttataattgcggctttgtgattcacggaaccagcaacaagaggacacgaatggcatgggccaaggtcacatgtgtggagagacttgg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24219751 |
tgttgttagtatctcataattgcggctttgtgattcaccgaaccaacaacaagaggacacgaacggcatgggccaaggtcacatgtgtggagagacttgg |
24219850 |
T |
|
| Q |
101 |
gaaggattaattaggaggaaaacattttctggtttgctagctcggtatctagaaaggtgggagacgtaagctataccaagtttcattgtcannnnnnnat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
24219851 |
gaaggattaattaggaggaaaacattttctggtttgctagctcggtatctagaaaggtgggagacgtaagctataccaagtttcatcgtcatttttttat |
24219950 |
T |
|
| Q |
201 |
ttctaaatttaaaagagctaaggtgtccgaggtgagggtgaggggtagatcagtttggtggtggaacttcctttggaggagatggctttttgaatgagag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24219951 |
ttctaaatttaaaagagctaaggtgtccaaggtgagggtgaggggtagatcagtttggtggtggaacttcctttggaggagatggctttttgaatgagag |
24220050 |
T |
|
| Q |
301 |
aaggagagcctagagaaattcctacagttgctgtcaactgtggtgtggagtgcagaggttgatgcttggtcttgacacttagatgaaagtggttcttttt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24220051 |
aaggagagcctagagaaattcctacagttgctgtcaactgtggtgtggagtgcagaggttgatgcttggtcttgacacttagatgaaagtggttcttttt |
24220150 |
T |
|
| Q |
401 |
cggtccaatcagcctatgcttcgttagcgccggattttt |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24220151 |
cggtccaatcagcctatgcttcgttagcgccggattttt |
24220189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University