View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11537_low_37 (Length: 362)

Name: NF11537_low_37
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11537_low_37
NF11537_low_37
[»] chr5 (2 HSPs)
chr5 (271-344)||(25773016-25773089)
chr5 (32-78)||(25773596-25773642)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 271 - 344
Target Start/End: Complemental strand, 25773089 - 25773016
Alignment:
271 tgtggcaattctttccattttaaaagcgtacaacccaacaaaccatcgaatttcatatagaacaatggaactgc 344  Q
    |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
25773089 tgtgtcaattctttccattttaaaagcgtacaacccaacaaaccatcaaatttcatatagaacaatggaactgc 25773016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 32 - 78
Target Start/End: Complemental strand, 25773642 - 25773596
Alignment:
32 aaaataagtataatttgttacaatatgatgaaaatttatattatagt 78  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
25773642 aaaataagtgtaatttgttacaatatgatgaaaatttatattatagt 25773596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University